On mRNA/Gene Therapy

Moderators: Elvis, DrVolin, Jeff

Re: On mRNA/Gene Therapy

Postby Belligerent Savant » Sun Mar 13, 2022 11:48 am

https://www.sciencedirect.com/science/a ... via%3Dihub
Acute disseminated encephalomyelitis following vaccination against SARS-CoV-2: A case report

Brain, Behavior, & Immunity - Health
Volume 20, March 2022, 100439

Highlights


Acute disseminated encephalomyelitis is a monophasic acute non-vasculitic inflammatory demyelinating disorder of the central nervous system.


Pathogenesis is suspected to be related to an autoimmune response to myelin triggered by infection or immunisation via molecular mimicry.


Once the SARS-CoV-2 infection was declared a global pandemic, vaccines became one the most important strategies to reduce mortality.


There is current uncertainty about the safety and efficacy of vaccines in all populations of interest.
User avatar
Belligerent Savant
 
Posts: 5612
Joined: Mon Oct 05, 2009 11:58 pm
Location: North Atlantic.
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Belligerent Savant » Sun Mar 20, 2022 9:55 pm

April 25th - May 1st 1992
The Economist Magazine.

Image
https://www.coverbrowser.com/covers/economist/38#i1898
User avatar
Belligerent Savant
 
Posts: 5612
Joined: Mon Oct 05, 2009 11:58 pm
Location: North Atlantic.
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Belligerent Savant » Fri Mar 25, 2022 6:23 pm

.

Who's to say current mRNA products don't already do this via 'shedding'?

Image

https://sea.mashable.com/life/19819/sci ... s-vaccines
User avatar
Belligerent Savant
 
Posts: 5612
Joined: Mon Oct 05, 2009 11:58 pm
Location: North Atlantic.
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby drstrangelove » Sun Mar 27, 2022 6:45 am

Australian football season has started.
Worrying scenes of AFL star in changeroom after fainting mid-game
There were scary scenes on Thursday night when Hayden Crozier inexplicably collapsed at halftime of the Western Bulldogs’ AFL game.

- https://www.news.com.au/sport/afl/just- ... 45750b2801

AFL great Matthew Lloyd reveals shock health diagnosis
Essendon great Matthew Lloyd has revealed he’s been diagnosed with Bell’s palsy - a form of facial paralysis.

The exact cause of the condition is unknown, but it’s believed to occur when cranial nerves become inflames or swollen. It is most often temporary and can be treated through the use of oral steroids.

- https://www.foxsports.com.au/afl/teams/ ... c9a7404d4a

I read ages ago that most AFL players didn't get the Pfizer vaccine, they got AZ instead. But for the booster they have to get mRNA. There are currently 12 players on one team that are refusing to get the booster.

At least 12 Eagles AFL players ruled out over COVID-19 vaccines
At least 12 West Coast Eagles players have been ruled out of this weekend's AFL game due to lagging third COVID-19 vaccine doses.

- https://www.9news.com.au/videos/nationa ... l43q0ebf6x
drstrangelove
 
Posts: 985
Joined: Sat May 22, 2021 10:43 am
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Joe Hillshoist » Sun Mar 27, 2022 5:10 pm

drstrangelove » 27 Mar 2022 20:45 wrote:Australian football season has started.
Worrying scenes of AFL star in changeroom after fainting mid-game
There were scary scenes on Thursday night when Hayden Crozier inexplicably collapsed at halftime of the Western Bulldogs’ AFL game.

- https://www.news.com.au/sport/afl/just- ... 45750b2801

AFL great Matthew Lloyd reveals shock health diagnosis
Essendon great Matthew Lloyd has revealed he’s been diagnosed with Bell’s palsy - a form of facial paralysis.

The exact cause of the condition is unknown, but it’s believed to occur when cranial nerves become inflames or swollen. It is most often temporary and can be treated through the use of oral steroids.

- https://www.foxsports.com.au/afl/teams/ ... c9a7404d4a

I read ages ago that most AFL players didn't get the Pfizer vaccine, they got AZ instead. But for the booster they have to get mRNA. There are currently 12 players on one team that are refusing to get the booster.

At least 12 Eagles AFL players ruled out over COVID-19 vaccines
At least 12 West Coast Eagles players have been ruled out of this weekend's AFL game due to lagging third COVID-19 vaccine doses.

- https://www.9news.com.au/videos/nationa ... l43q0ebf6x


That's funny because the story is all 42 Eagles players unable to play yesterday had COVID and were in iso, well about 25 of them anyway. So they had a bunch of ring ins from the wafl. They had one guy playing who was gonna refuse vax but changed his mind and got Novavax (I assume). He played like shit anyway lol.

I would have thought if 12 eagles players were refusing boosters ambulance chasers like Tom Morris Browne would be all over it by now.

My favorite player had Pericarditis (In December) and won't be back until at least May by the looks of things (tho we need him back now.) AFAIK he is the only player to have a reaction to the vaccines. One in eight hundred is about the rate for bad reactions in most studies.

As for Lloyd. Well I have heard that Bell's palsy is one long term side effect of being a sniping cunt.
Joe Hillshoist
 
Posts: 10625
Joined: Mon Jun 12, 2006 10:45 pm
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby norton ash » Sun Mar 27, 2022 6:12 pm

Canada just qualified for FIFA World Cup without star Alphonso Davies. (Myocarditis.)
Zen horse
User avatar
norton ash
 
Posts: 4067
Joined: Wed Nov 08, 2006 5:46 pm
Location: Canada
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby drstrangelove » Sun Mar 27, 2022 9:05 pm

Joe Hillshoist » Sun Mar 27, 2022 5:10 pm wrote:
drstrangelove » 27 Mar 2022 20:45 wrote:Australian football season has started.
Worrying scenes of AFL star in changeroom after fainting mid-game
There were scary scenes on Thursday night when Hayden Crozier inexplicably collapsed at halftime of the Western Bulldogs’ AFL game.

- https://www.news.com.au/sport/afl/just- ... 45750b2801

AFL great Matthew Lloyd reveals shock health diagnosis
Essendon great Matthew Lloyd has revealed he’s been diagnosed with Bell’s palsy - a form of facial paralysis.

The exact cause of the condition is unknown, but it’s believed to occur when cranial nerves become inflames or swollen. It is most often temporary and can be treated through the use of oral steroids.

- https://www.foxsports.com.au/afl/teams/ ... c9a7404d4a

I read ages ago that most AFL players didn't get the Pfizer vaccine, they got AZ instead. But for the booster they have to get mRNA. There are currently 12 players on one team that are refusing to get the booster.

At least 12 Eagles AFL players ruled out over COVID-19 vaccines
At least 12 West Coast Eagles players have been ruled out of this weekend's AFL game due to lagging third COVID-19 vaccine doses.

- https://www.9news.com.au/videos/nationa ... l43q0ebf6x


That's funny because the story is all 42 Eagles players unable to play yesterday had COVID and were in iso, well about 25 of them anyway. So they had a bunch of ring ins from the wafl. They had one guy playing who was gonna refuse vax but changed his mind and got Novavax (I assume). He played like shit anyway lol.

I would have thought if 12 eagles players were refusing boosters ambulance chasers like Tom Morris Browne would be all over it by now.

My favorite player had Pericarditis (In December) and won't be back until at least May by the looks of things (tho we need him back now.) AFAIK he is the only player to have a reaction to the vaccines. One in eight hundred is about the rate for bad reactions in most studies.

As for Lloyd. Well I have heard that Bell's palsy is one long term side effect of being a sniping cunt.

Well it's one out of however many took an mRNA shot, assuming that player did. The problem with AZ was the blood clots.

Yes I saw the other reports about the eagles players. So there's a report about 'at least' 12 who haven't gotten the booster jab, which must be an mRNA this time round unless you get exempted. Then other reports about there being a covid outbreak.

Now, what would happen if enough players on one team got together and refused the booster shot? The AFL would cover it up for as long as they could to negotiate behind the scenes some kind of arrangement. The press would be too bad to have an entire team boycotting the booster shot just when our government is trying to roll out the forth jab. Also, it could be the players avoiding the booster shot by getting covid, or at least 'returning' positive tests, so that they don't have to get the jab. Which is probably the most likely case. If you've been infected within the last however many months it is now, you can defer your booster.

Since PCR tests return false positives, all they need to do is keep testing their players until they return a false positive, then use that to avoid the jab for 6 months.
drstrangelove
 
Posts: 985
Joined: Sat May 22, 2021 10:43 am
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby stickdog99 » Mon Mar 28, 2022 3:07 am

LOL at the blithe normalization of severe vaccine injuries among almost all of those who fell for getting them.
stickdog99
 
Posts: 6744
Joined: Tue Jul 12, 2005 5:42 am
Blog: View Blog (0)


Re: On mRNA/Gene Therapy

Postby stickdog99 » Mon Mar 28, 2022 5:51 pm

Discussion: The Hubris of Modern Medicine Caused Billions to Be Injected With "Hidden Genes" in the mRNA Sequences in COVID-19 Vaccines. It's Time We Tell Them We Know.

Now we have yet another reason to no trust public health. The public health agenda caused billions of people around the planet to be injected with the spike-protein encoding RNAs without first determining whether other parts of the RNA might be read as other proteins.

I first reported that the complementary sequence to the Pfizer full-length mRNA sequence encodes a complete and uninterrupted open reading frame - the full length of the sequence.

Now, a peer-reviewed paper from The University of Cambridge has asked “Are There Hidden Genes in DNA/RNA Vaccines?”

The authors reported:

“Eleven small overlapping ORFs (27-87 residues long) were discovered using NCBI ORFfinder on the wild-type spike protein sequence, and eight small ORFs (26-52 residues long) were found to overlap the Pfizer BNT162b2 vaccine mRNA sequence. Notably, the Moderna mRNA-1273 vaccine mRNA sequence displayed no overlapping sequences on the positive sense strand – only on the negative sense strand…”


They presume there is not issue with the ORFs on the negative sense strand, apparently unaware of the studies that show the mRNA is, in fact, incorporated into the tissue of fast-dividing cells.

Proteins not found in the human genome expressed by human cells with lead to cytotoxic t-cells attacking them and initiative cell death. Therefore, cellular damage and organ damage will occur due to these unintended, preventable proteins translated by the protein-producing machinery of our cells.

Read the paper’s conclusions. Clearly, these steps should have been done before unleashing this biologic on the human population:

"Although the wild-type SARS-CoV-2 spike protein nucleotide sequence has been found to code for translated overlapping genes, ORF detection predictions on the sequences of two mRNA vaccines reveal that codon optimization has the potential to disrupt non-specific translation. Additional overlapping ORFs can arise during codon optimization; thus, the final sequences should nevertheless be scrutinized for their protein-coding potential. In the case of DNA vaccines and viral vectors, the negative-sense strand should also be checked for its protein-coding potential. Additionally, as variants of concern become known and vaccines are altered to include them, the spontaneous generation of ORFs should be re-assessed. Many precautionary steps have been taken to ensure the safety and efficacy of the mRNA vaccines, including nucleoside modification to reduce inflammatory responses and 5’-capping and polyadenylation tail length optimization to increase mRNA stability and translation... Thus, the inclusion of additional steps to ensure that vaccine sequences code solely for the intended protein may also lead to better health and safety outcomes. Measures to check for other adverse effects on host cells, such as those resulting from potential interactions of vaccine nucleotide sequences with host RNAs or proteins, or the host microbiome may be increase efficacy and safety as well..⁠. More in-depth investigation of these delivery methods may reveal aspects that should be further refined to safeguard against unintended side effects."


It is utterly unacceptable that Moderna and Pfizer did not catch this, and it is similarly unacceptable that FDA and CDC organizations such a VRBPAC and ACIP did not catch this.

There is no plan to update the Moderna and Pfizer vaccines to disrupt these open reading frames - or to remove the unsafe epitopes that can lead to autoimmunity against proteins, including many of those in our immune systems.

It’s time we take the bad news that the public knows, and understands how the rush to vaccines was not even close to “science”, but instead was mayhem.
stickdog99
 
Posts: 6744
Joined: Tue Jul 12, 2005 5:42 am
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Pele'sDaughter » Tue Mar 29, 2022 7:42 am

I had reason to be looking for a mobile auto detailer on Saturday morning. One didn't answer. The next did and the man said he couldn't come out that day, because he was just getting released from hospital after having a heart attack just two weeks after getting the 2nd booster. While he was a proponent before, he certainly isn't now and blames the jab for his condition. He's the first person I've actually met who has had such a reaction, although I've heard of others. There are still many who don't seem to have had any side effects, but I wonder if it will catch up with them later.
Don't believe anything they say.
And at the same time,
Don't believe that they say anything without a reason.
---Immanuel Kant
User avatar
Pele'sDaughter
 
Posts: 1917
Joined: Thu Sep 13, 2007 11:45 am
Location: Texas
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Belligerent Savant » Wed Apr 06, 2022 5:38 pm

.

Very informative piece.

https://ashmedai.substack.com/p/gain-of ... uccess?s=r

Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?

Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT

April 5


Skipping to the conclusion section:

What did the study discover?

First off, they observed that the codon optimization achieved its objective, significantly boosting the protein yield of the mRNA in the vaccines. Unfortunately for us, since spike proteins are incredibly toxic, that is not a good thing, and it’s all downhill from here.

Next, they discovered that the vaccine optimized spike proteins were carrying an whole smorgasbord of different mutations all across the spike protein. Curiously, despite producing a far greater quantity of spike protein, the psuedovirions using a far lower quantity of the native virus spike protein were nevertheless far more infectious than the psuedovirions that had a greater reservoir of the modified vaccine spike proteins. Put simply, the mutant spikes produced from the vaccine mRNA functioned about as well as low quality cheap Chinese knockoffs. This is not to say that all of the spike proteins were “messed up”, just that an appreciable percentage of them were.

This has some chilling implications for the immune response elicited by the vaccines (obviously we don’t care whether the vaccine spike proteins would work well if they were attached to real covid virus particles). Spike proteins that are mutated weirdly in a variety of ways will cause the immune system to produce antibodies to their bizarre or misshapen spike peptides. Such antibodies will not work all that well if at all against an actual covid virus spike protein, because the pathogen-specific cells, particularly the T/B-Cells & antibodies, generated against the vaccine spikes are programmed to recognize and bind to a part of the spike protein that doesn’t actually exist on the virus spike protein (of any variant).

Might these sorts of hobbled antibodies cause or supercharge an ADE (Antibody Disease Enhancement) or OAS (Original Antigenic Sin or Antigenic Priming) pathology because a significant portion of the antibodies created in response to the vaccine could be targeting these mutant spikes? Very plausibly, yes.

(Briefly, ADE refers to a phenomenon whereby substandard immune cells that are specific to a pathogen instead of helping to fight the pathogen make the pathogen more ‘powerful’ or potent; OAS refers to the phenomenon whereby the immune system ‘locks in’ the first version of a pathogen it is exposed to, so that if you subsequently get infected by a different strain of that pathogen, instead of making a new batch of immune-specific cells to match the ‘updated' parts of the new strain of the pathogen, the immune system manufactures the immune cells designed for the original strain to fight the new strain.)

And that’s not all. As everyone is probably also aware, spike protein pieces have been discovered to be capable of penetrating the cell nucleus, where they can damage or inhibit DNA repair mechanisms that are necessary to prevent undesirable developments such as cancers (and perhaps also interfere with other critical functions that we haven’t discovered yet). So what can an assortment of weirdly mutated spike bits do? Where might they end up? Good questions, but considering the mind-numbing carnage already wreaked by the covid vaccines so far, the answer is likely to be uncomforting.

Ultimately, we have no idea of what potentially toxic mutant peptides might be produced in relevant quantities, and where in the anatomy such toxicities might be manifest; and nor do we know how this affects the immune system. That we are burdened by such profound unknowns regarding the vaccine products is a testament to the utter and complete collapse of the regulatory regime.


From the comments:


Commoncents 24 hr ago

Before I read to BONUS ENHANCEMENT # 5, I was thinking "Cancers are going to explode".
User avatar
Belligerent Savant
 
Posts: 5612
Joined: Mon Oct 05, 2009 11:58 pm
Location: North Atlantic.
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Pele'sDaughter » Thu Apr 07, 2022 7:24 am

Does anyone remember when a member here mentioned "aliens" are probably mankind from the future coming back to try and salvage our DNA? It sounded implausible at the time, but not so much now.
Don't believe anything they say.
And at the same time,
Don't believe that they say anything without a reason.
---Immanuel Kant
User avatar
Pele'sDaughter
 
Posts: 1917
Joined: Thu Sep 13, 2007 11:45 am
Location: Texas
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby stickdog99 » Thu Apr 07, 2022 6:17 pm

stickdog99
 
Posts: 6744
Joined: Tue Jul 12, 2005 5:42 am
Blog: View Blog (0)

Re: On mRNA/Gene Therapy

Postby Harvey » Thu Apr 07, 2022 6:35 pm

Pele'sDaughter » Thu Apr 07, 2022 12:24 pm wrote:Does anyone remember when a member here mentioned "aliens" are probably mankind from the future coming back to try and salvage our DNA? It sounded implausible at the time, but not so much now.


Yes. Sometimes when I think of the enormity of what just happened to us, I simply shut down. But as you say, it does cast some former ideas in a new light.

A long time ago I wrote a time travel story in which the time travellers don't actually travel in time, they are experiencers of other times. In the story, in the future, junk DNA becomes recognised as coherent information and is eventually decoded. At the same moment, a kind of limited time travel becomes available but nothing more than clouds of virus are sent back in time - deliberately - to cause mass infections. The virus is designed to write the lived experience of all those who are infected into their own genome as junk DNA, via the viral RNA, allowing for that data to be sampled directly from the genome at any later point. When decoded into virtual experience, our time travellers can literally live past lives by extracting the experiential data stored in human DNA which resulted from the time travelling virus. Using VR technology they can literally re-live the past experience of actual humans from their own DNA. Of course, complications ensue when the time-experiencers/time travellers realise that they are somehow affecting the past lives they thought they were passively experiencing virtually. Simply by experiencing these past lives they are changing the past and creating paradoxes.

In my own thoughts I was pretty much always open to the idea that few/some/all alien encounters might actually be encounters with time travellers, with future humans. Or maybe with inter dimensional beings as Graham Hancock puts it.

Anyway, all our generations are seeing the future form into a hell scape of competing genomic warfare combatants, in the context of global warming, industrial pollution and environmental destruction. We are seeing all the scientific dystopia's of our fictions crystallise in the here and now, while we are seemingly powerless to stop it.
And while we spoke of many things, fools and kings
This he said to me
"The greatest thing
You'll ever learn
Is just to love
And be loved
In return"


Eden Ahbez
User avatar
Harvey
 
Posts: 4236
Joined: Mon May 09, 2011 4:49 am
Blog: View Blog (20)

PreviousNext

Return to General Discussion

Who is online

Users browsing this forum: No registered users and 28 guests